Navegando por Autor "Padovani, Carlos Roberto"
Agora exibindo 1 - 6 de 6
Resultados por página
Opções de Ordenação
Item Colonization of vines by Petri disease fungi, susceptibility of rootstocks to Phaeomoniella chlamydospora and their disinfection(2018) Ferreira, Ana Beatriz Monteiro; Leite, Luís Garrigós; Hernandes, José Luiz; Harakava, Ricardo; Padovani, Carlos Roberto; Bueno, César JuniorABSTRACT: Petri disease is complex, attacks young vine plants and it is difficult to be controlled. The fungus Phaeomoniella chlamydospora (Phc) has been identified as the main causative agent of this disease. This study aimed to evaluate the prevalent colonization of the Petri disease fungi in different portions of vine plants; to assess the susceptibility of grapevine rootstocks to the fungus P. chlamydospora; to assess the effect of solarization and biofumigation, followed by hot-water treatment (HWT), on the disinfection of cuttings of the rootstock IAC 766 infected with P. chlamydospora, and assess the effect of solarization and biofumigation, followed by HWT, on the rooting of cuttings of the rootstock IAC 766. For the prevalent colonization test, the fungus species detected and identified in ‘Niagara Rosada’ grafted on two rootstocks different were Phc and Phialemoniopsis ocularis. This is the first report of P. ocularis in a young vineyard in Brazil. Both fungi, in particular Phc, colonized only the plant’s basal part, drawing attention to the rootstock as target for control measures. Measurement of the dark streaks in the vascular system revealed that Golia was the least susceptible rootstock, and IAC 572 was the most susceptible to Phc. Moreover, biofumigation or temperature of 37°C applied for 7 and 14 days, both followed by HWT, suppressed Phc in cuttings of the rootstock IAC 766 without hampering their rooting. Meanwhile, new studies are needed to validate the efficiency of these disinfection techniques. RESUMO: A doença de Petri é complexa, ataca plantas jovens de videira e é difícil de ser controlada. O fungo Phaeomoniella chlamydospora é o principal agente causal dessa doença. Os objetivos deste estudo foram: avaliar o local prevalente dos fungos da doença de Petri, em diferentes partes de plantas de videira; avaliar a suscetibilidade de porta-enxertos de videira para o fungo P. chlamydospora; avaliar o efeito da solarização e da biofumigação seguido de tratamento com água quente sobre a desinfecção de estacas do porta-enxerto IAC 766 infectadas com o fungo P. chlamydospora; avaliar o efeito da solarização e da biofumigação seguido de tratamento com água quente sobre o enraizamento de estacas do porta-enxerto IAC 766. Para o teste de colonização, as espécies de fungos detectadas e identificadas em Niagara Rosada enxertada em dois porta-enxertos diferentes foram P. chlamydospora e Phialemoniopsis ocularis. Este é o primeiro relato de P. ocularis em parrerais jovens de videira no Brasil. Ambos os fungos, em particular P. chlamydospora, colonizaram somente a parte basal das plantas, destacando-se os porta-enxertos como foco para medidas de controle. Medidas das estrias escuras no sistema vascular revelaram que Golia foi o porta-enxerto menos suscetível, e o IAC 572 foi o mais suscetíveis para P. chlamydospora. Além disso, a biofumigação ou a temperatura de 37ºC aplicadas por 7 e 14 dias seguidas de tratamento com água quente eliminaram P. chlamydospora em estacas do porta-enxerto IAC 766 sem afetar o enraizamento. No entanto, novos estudos são necessários ainda para validar a eficiência dessas técnicas de desinfecção.Item Colonization of vines by Petri disease fungi, susceptibility of rootstocks to Phaeomoniella chlamydospora and their disinfection(2018) Ferreira, Ana Beatriz Monteiro; Leite, Luís Garrigós; Hernandes, José Luiz; Harakava, Ricardo; Padovani, Carlos Roberto; Bueno, César JuniorABSTRACT: Petri disease is complex, attacks young vine plants and it is difficult to be controlled. The fungus Phaeomoniella chlamydospora (Phc) has been identified as the main causative agent of this disease. This study aimed to evaluate the prevalent colonization of the Petri disease fungi in different portions of vine plants; to assess the susceptibility of grapevine rootstocks to the fungus P. chlamydospora; to assess the effect of solarization and biofumigation, followed by hot-water treatment (HWT), on the disinfection of cuttings of the rootstock IAC 766 infected with P. chlamydospora, and assess the effect of solarization and biofumigation, followed by HWT, on the rooting of cuttings of the rootstock IAC 766. For the prevalent colonization test, the fungus species detected and identified in ‘Niagara Rosada’ grafted on two rootstocks different were Phc and Phialemoniopsis ocularis. This is the first report of P. ocularis in a young vineyard in Brazil. Both fungi, in particular Phc, colonized only the plant’s basal part, drawing attention to the rootstock as target for control measures. Measurement of the dark streaks in the vascular system revealed that Golia was the least susceptible rootstock, and IAC 572 was the most susceptible to Phc. Moreover, biofumigation or temperature of 37°C applied for 7 and 14 days, both followed by HWT, suppressed Phc in cuttings of the rootstock IAC 766 without hampering their rooting. Meanwhile, new studies are needed to validate the efficiency of these disinfection techniques. RESUMO: A doença de Petri é complexa, ataca plantas jovens de videira e é difícil de ser controlada. O fungo Phaeomoniella chlamydospora é o principal agente causal dessa doença. Os objetivos deste estudo foram: avaliar o local prevalente dos fungos da doença de Petri, em diferentes partes de plantas de videira; avaliar a suscetibilidade de porta-enxertos de videira para o fungo P. chlamydospora; avaliar o efeito da solarização e da biofumigação seguido de tratamento com água quente sobre a desinfecção de estacas do porta-enxerto IAC 766 infectadas com o fungo P. chlamydospora; avaliar o efeito da solarização e da biofumigação seguido de tratamento com água quente sobre o enraizamento de estacas do porta-enxerto IAC 766. Para o teste de colonização, as espécies de fungos detectadas e identificadas em Niagara Rosada enxertada em dois porta-enxertos diferentes foram P. chlamydospora e Phialemoniopsis ocularis. Este é o primeiro relato de P. ocularis em parrerais jovens de videira no Brasil. Ambos os fungos, em particular P. chlamydospora, colonizaram somente a parte basal das plantas, destacando-se os porta-enxertos como foco para medidas de controle. Medidas das estrias escuras no sistema vascular revelaram que Golia foi o porta-enxerto menos suscetível, e o IAC 572 foi o mais suscetíveis para P. chlamydospora. Além disso, a biofumigação ou a temperatura de 37ºC aplicadas por 7 e 14 dias seguidas de tratamento com água quente eliminaram P. chlamydospora em estacas do porta-enxerto IAC 766 sem afetar o enraizamento. No entanto, novos estudos são necessários ainda para validar a eficiência dessas técnicas de desinfecção.Item Colonization of vines by Petri disease fungi, susceptibility of rootstocks to Phaeomoniella chlamydospora and their disinfection(2018) Ferreira, Ana Beatriz Monteiro; Leite, Luís Garrigós; Hernandes, José Luiz; Harakava, Ricardo; Padovani, Carlos Roberto; Bueno, César JuniorABSTRACT: Petri disease is complex, attacks young vine plants and it is difficult to be controlled. The fungus Phaeomoniella chlamydospora (Phc) has been identified as the main causative agent of this disease. This study aimed to evaluate the prevalent colonization of the Petri disease fungi in different portions of vine plants; to assess the susceptibility of grapevine rootstocks to the fungus P. chlamydospora; to assess the effect of solarization and biofumigation, followed by hot-water treatment (HWT), on the disinfection of cuttings of the rootstock IAC 766 infected with P. chlamydospora, and assess the effect of solarization and biofumigation, followed by HWT, on the rooting of cuttings of the rootstock IAC 766. For the prevalent colonization test, the fungus species detected and identified in ‘Niagara Rosada’ grafted on two rootstocks different were Phc and Phialemoniopsis ocularis. This is the first report of P. ocularis in a young vineyard in Brazil. Both fungi, in particular Phc, colonized only the plant’s basal part, drawing attention to the rootstock as target for control measures. Measurement of the dark streaks in the vascular system revealed that Golia was the least susceptible rootstock, and IAC 572 was the most susceptible to Phc. Moreover, biofumigation or temperature of 37°C applied for 7 and 14 days, both followed by HWT, suppressed Phc in cuttings of the rootstock IAC 766 without hampering their rooting. Meanwhile, new studies are needed to validate the efficiency of these disinfection techniques. RESUMO: A doença de Petri é complexa, ataca plantas jovens de videira e é difícil de ser controlada. O fungo Phaeomoniella chlamydospora é o principal agente causal dessa doença. Os objetivos deste estudo foram: avaliar o local prevalente dos fungos da doença de Petri, em diferentes partes de plantas de videira; avaliar a suscetibilidade de porta-enxertos de videira para o fungo P. chlamydospora; avaliar o efeito da solarização e da biofumigação seguido de tratamento com água quente sobre a desinfecção de estacas do porta-enxerto IAC 766 infectadas com o fungo P. chlamydospora; avaliar o efeito da solarização e da biofumigação seguido de tratamento com água quente sobre o enraizamento de estacas do porta-enxerto IAC 766. Para o teste de colonização, as espécies de fungos detectadas e identificadas em Niagara Rosada enxertada em dois porta-enxertos diferentes foram P. chlamydospora e Phialemoniopsis ocularis. Este é o primeiro relato de P. ocularis em parrerais jovens de videira no Brasil. Ambos os fungos, em particular P. chlamydospora, colonizaram somente a parte basal das plantas, destacando-se os porta-enxertos como foco para medidas de controle. Medidas das estrias escuras no sistema vascular revelaram que Golia foi o porta-enxerto menos suscetível, e o IAC 572 foi o mais suscetíveis para P. chlamydospora. Além disso, a biofumigação ou a temperatura de 37ºC aplicadas por 7 e 14 dias seguidas de tratamento com água quente eliminaram P. chlamydospora em estacas do porta-enxerto IAC 766 sem afetar o enraizamento. No entanto, novos estudos são necessários ainda para validar a eficiência dessas técnicas de desinfecção.Item Culture media to detect and criteria to evaluate and report the activity of extracellular enzymes produced by phytopathogenic fungi(2019) Ferreira, Ana Beatriz Monteiro; Fischer, Ivan Herman; Leite, Luís Garrigós; Padovani, Carlos Roberto; Bueno, César JúniorABSTRACT: Extracellular enzymes are involved in the fungal pathogenesis in plants. Currently, culture media, data analyses, and data report related to extracellular enzymes produced in vitro conditions are different and therefore, lack standardization. This work aimed to compare the culture media cited on the literature (normal) with the potato-dextrose-agar (PDA) medium combined with a specific compound to produce extracellular enzymes through three soilborne phytopathogenic fungi (F. solani f. sp. passiflorae, S. rolfsii, and R. solani AG-4 HGI), as well as to analyze and report enzyme data based on five different criteria. The assay was randomized, with three factors (culture media, isolates, and enzymes) and six repetitions. The studied enzymes were amylase (AM), carboxymethylcellulase (CMCase), lipase (LP), laccase (LC), catalase (CT), and gelatinase (GT). The normal media detected more enzymes and was more precise compared to the PDA medium plus specific compound. The criteria that calculated the area of the circular crown of AM, CMCase, LP, and LC and measured the intensity (0 = absence, up to 4 = intense) of CT and GT adopting note scale were the best to evaluate and report the results of the enzymes. We suggest the normal media culture to study enzyme production, as well as the criteria mentioned to assess and report the data related to enzyme activities. RESUMO: As enzimas extracelulares estão envolvidas na patogênese de fungos em plantas. Atualmente, não há uma padronização de meios de cultura, formas de analisar e divulgar os dados de enzimas extracelulares produzidas em condições in vitro. Assim, o presente trabalho objetivou comparar os meios de cultura específicos relatados na literatura (normal) com o meio de batata-dextrose-ágar mais adição do substrato específico para produção de enzimas extracelulares por três diferentes fungos fitopatogênicos habitantes de solo (Fusarium solani f. sp. passiflorae, Sclerotium rolfsii e Rhizoctonia solani AG-4 HGI), bem como avaliar os dados das enzimas por cinco critérios diferentes. O delineamento experimental adotado foi o inteiramente ao acaso, em esquema de três fatores (meios, isolados e enzimas), com seis repetições. As enzimas investigadas foram amilase, carboximetilcelulase, lipase, lacase, catalase e gelatinase. Os meios normais detectaram mais enzimas, e essa detecção foi mais precisa em comparação com os meios de batata-dextrose-ágar mais o substrato específico. Os critérios que calcularam a área da coroa circular para as enzimas amilase, carboximetilcelulase, lipase e lacase e adotaram a escala de notas para medir a intensidade (0=ausência até 4=intensa) de catalase e gelatinase foram os melhores para avaliar e divulgar os resultados das enzimas. Assim, sugere-se padronizar os meios normais para estudos de produção de enzimas, bem como os critérios citados para avaliar e divulgar os dados das atividades das referidas enzimas.Item Incidência da doença de Petri na videira ‘Niagara Rosada’ no estado de São Paulo - Brasil(2017) Ferreira, Ana Beatriz Monteiro; Leite, Luís Garrigós; Harakava, Ricardo; Padovani, Carlos Roberto; Bueno, César JúniorABSTRACT The Petri disease caused mainly by Phaeomoniella chlamydospora and species of Phaeoacremonium is serious, complex, attacks young vine plants and is difficult to be controlled worldwide. In Brazil, São Paulo State is among the largest producers of ‘Niagara Rosada’ grapevine, and there is no official report of this disease in the state. Thus, the aims of the present study were to evaluate the incidence of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State and to compare methodologies to isolate the causal agents of this disease. Experimental design was completely randomized, testing three culture media (water-agar [WA], potato dextrose agar [PDA] and apple-green bait) with samples of diseased plants, disinfested or not, from nine sampling locality and eight replicates (Petri dish with the media and four fragments of the plants per sample). The number of colonies of causal agents per fragment per dish of each culture medium per locality was determined. Fungal isolates obtained by DNA extraction and sequencing of ITS-5.8S rDNA region [ITS1 TCCGTAGGTGAACCTGCGG and ITS4 TCCTCCGCTTATTGATATGC] and parts of the alpha elongase genes [EF1 ATGGGTAAGGARGACAAGAC and EF2 GGARGTACCAGTSATCATGTT] and beta tubulin genes [Bt2a GGTAACCAAATCGGTGCTGCTTTC and Bt2b ACCCTCAGTGTAGTGACCCTTGGC] were identified. Pathogenicity test was done with one isolate of Phaeomoniella spp. and one isolate of Phaeoacremonium spp. The disease incidence and severity (length of dark streaks in the vascular system) were evaluated. The municipalities Louveira B, Vinhedo, Jundiaí, Jarinu, Porto Feliz, Sao Miguel Arcanjo and Jales were the localities where the causal agents of the disease were present, demonstrating that the Petri disease occurs throughout São Paulo State. The most prevalent species of Phaeoacremonium was P. minimum (= P. aleophilum). Besides P. minimum, the species P. venezuelense was detected only in the municipality of Jales. P. chlamydospora was the only species identified within this genus. Isolation percentage was higher for P. chlamydospora than for Phaeoacremonium spp. The causal agents of the disease must be isolated by removing fragments of the vascular system from the collar region of symptomatic plants, followed by surface disinfection and plating of fragments in PDA culture medium. Incubation in BOD should be at 23ºC for up to 21 days. The apple-green bait method followed by culturing in PDA did not allow isolation of any of the causal agents of the disease. All inoculated plants developed external symptoms and internally the average length of dark streaks was 7.9 cm for P. chlamydospora and 5.2 cm for P. minimum. Control plants remained healthy. Fungi were re-isolated from diseased plants, completing the Koch’s postulates, thus making official the record of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State, Brazil. RESUMO A doença de Petri causada, principalmente, por Phaeomoniella chlamydospora e espécies de Phaeoacremonium é grave, complexa, ataca plantas jovens de videira e é de difícil controle no mundo. No Brasil, o estado de São Paulo está entre os maiores produtores da uva ‘Niagara Rosada’ e não há relato oficial desta doença no estado. Assim, os objetivos do presente trabalho foram avaliar a incidência da doença de Petri na videira ‘Niagara Rosada’ no estado de São Paulo e comparar metodologias para isolar os agentes causais da doença. O delineamento foi inteiramente casualizado, testando-se três meios de isolamento [ágar-água (AA), batata dextrose ágar (BDA) e isca de maçã-verde], com amostras de plantas doentes desinfestadas ou não, nove localidades de coleta e oito repetições (placa de Petri com os meios e quatro fragmentos das plantas por amostra). Anotou-se o número de colônias dos agentes causais por fragmento por placa de cada meio de cultura por localidade. Identificaram-se os isolados dos fungos obtidos por extração de DNA e sequenciamento da região ITS-5.8S do rDNA [ITS1 TCCGTAGGTGAACCTGCGG e ITS4 TCCTCCGCTTATTGATATGC] e partes dos genes da alfa elongase [EF1 ATGGGTAAGGARGACAAGAC e EF2 GGARGTACCAGTSATCATGTT] e da beta tubulina [Bt2a GGTAACCAAATCGGTGCTGCTTTC e Bt2b ACCCTCAGTGTAGTGACCCTTGGC]. Teste de patogenicidade foi feito com um isolado de Phaeomoniella spp. e um de Phaeoacremonium spp. A incidência e a severidade da doença (comprimento das estrias escuras no sistema vascular) foram avaliadas. Os municípios de Louveira B, Vinhedo, Jundiaí, Jarinú, Porto Feliz, São Miguel Arcanjo e Jales foram os que apresentaram a presença dos agentes causais da doença, demonstrando ocorrência da doença de Petri em todo o estado de São Paulo. A espécie de Phaeoacremonium prevalente foi P. minimum (= P. aleophilum). Somente na cidade de Jales, além de P. minimum detectou-se, também, a espécie P. venezuelense. Phaeomoniella chlamydospora foi a única espécie identificada neste gênero. A porcentagem de isolamento foi maior para P. chlamydospora do que para Phaeoacremonium spp. O isolamento dos agentes causais da doença deve ser feito retirando fragmentos do sistema vascular da região do colo das plantas sintomáticas seguido de desinfestação superficial e plaqueamento de fragmentos em meio de cultura BDA. Incuba-se em BOD, a 23ºC, por até 21 dias. O método de isca e depois repicagem para BDA não permitiu isolar nenhum dos agentes causais da doença. Todas as plantas inoculadas desenvolveram sintomas externos e internamente a média do comprimento das estrias escuras para P. chlamydospora foi de 7,9 cm e de P. minimum foi de 5,2 cm. As plantas controle (testemunha) permaneceram sadias. Os fungos foram re-isolados das plantas doentes, completando os postulados de Koch e oficializando a doença de Petri na videira ‘Niagara Rosada’ no estado de São Paulo - Brasil.Item New treatments to disinfect vine cuttings with Phaeomoniella chlamydospora and the reason for the control(2022) Brambatti, Fabiana; Leite, Luís Garrigós; Padovani, Carlos Roberto; Bueno, César JúniorABSTRACT Petri disease is a problem for vineyard caused mainly by the fungus Phaeomoniella chlamydospora. Contaminated seedlings are source of inoculum for the disease. Treatment to disinfect vine rootstock cuttings for seedling production is hot water treatment (HWT) by 50 °C for 30 min, but the efficiency is contested. To improve its efficacy, the study aimed to assess the combination of the following methods and the reason for the control: i) exposition of the fungus to five different temperatures in HWT bath for 30 min; ii and iii) exposition of the fungus and also plants infected with P. chlamydospora to different disinfection treatments (biofumigation = soil + cabbage at 40 °C; temperatures of 40 and 23 °C, all in microcosm), in different periods (7, 14 and 21 days), with and without additional HWT (51 °C for 30 min). The results showed that HWT with high temperatures (55–70 °C) for 30 min inactivated the fungus. Biofumigation technique at 40 °C and the temperature solely of 40 °C applied for up to 21 days and combined with HWT (51 °C for 30 min) inhibited mycelial growth and inactivated the fungus in vine plant tissues without compromising the rooting.