Navegando por Autor "Harakava, Ricardo"
Agora exibindo 1 - 4 de 4
Resultados por página
Opções de Ordenação
Item Colonization of vines by Petri disease fungi, susceptibility of rootstocks to Phaeomoniella chlamydospora and their disinfection(2018) Ferreira, Ana Beatriz Monteiro; Leite, Luís Garrigós; Hernandes, José Luiz; Harakava, Ricardo; Padovani, Carlos Roberto; Bueno, César JuniorABSTRACT: Petri disease is complex, attacks young vine plants and it is difficult to be controlled. The fungus Phaeomoniella chlamydospora (Phc) has been identified as the main causative agent of this disease. This study aimed to evaluate the prevalent colonization of the Petri disease fungi in different portions of vine plants; to assess the susceptibility of grapevine rootstocks to the fungus P. chlamydospora; to assess the effect of solarization and biofumigation, followed by hot-water treatment (HWT), on the disinfection of cuttings of the rootstock IAC 766 infected with P. chlamydospora, and assess the effect of solarization and biofumigation, followed by HWT, on the rooting of cuttings of the rootstock IAC 766. For the prevalent colonization test, the fungus species detected and identified in ‘Niagara Rosada’ grafted on two rootstocks different were Phc and Phialemoniopsis ocularis. This is the first report of P. ocularis in a young vineyard in Brazil. Both fungi, in particular Phc, colonized only the plant’s basal part, drawing attention to the rootstock as target for control measures. Measurement of the dark streaks in the vascular system revealed that Golia was the least susceptible rootstock, and IAC 572 was the most susceptible to Phc. Moreover, biofumigation or temperature of 37°C applied for 7 and 14 days, both followed by HWT, suppressed Phc in cuttings of the rootstock IAC 766 without hampering their rooting. Meanwhile, new studies are needed to validate the efficiency of these disinfection techniques. RESUMO: A doença de Petri é complexa, ataca plantas jovens de videira e é difícil de ser controlada. O fungo Phaeomoniella chlamydospora é o principal agente causal dessa doença. Os objetivos deste estudo foram: avaliar o local prevalente dos fungos da doença de Petri, em diferentes partes de plantas de videira; avaliar a suscetibilidade de porta-enxertos de videira para o fungo P. chlamydospora; avaliar o efeito da solarização e da biofumigação seguido de tratamento com água quente sobre a desinfecção de estacas do porta-enxerto IAC 766 infectadas com o fungo P. chlamydospora; avaliar o efeito da solarização e da biofumigação seguido de tratamento com água quente sobre o enraizamento de estacas do porta-enxerto IAC 766. Para o teste de colonização, as espécies de fungos detectadas e identificadas em Niagara Rosada enxertada em dois porta-enxertos diferentes foram P. chlamydospora e Phialemoniopsis ocularis. Este é o primeiro relato de P. ocularis em parrerais jovens de videira no Brasil. Ambos os fungos, em particular P. chlamydospora, colonizaram somente a parte basal das plantas, destacando-se os porta-enxertos como foco para medidas de controle. Medidas das estrias escuras no sistema vascular revelaram que Golia foi o porta-enxerto menos suscetível, e o IAC 572 foi o mais suscetíveis para P. chlamydospora. Além disso, a biofumigação ou a temperatura de 37ºC aplicadas por 7 e 14 dias seguidas de tratamento com água quente eliminaram P. chlamydospora em estacas do porta-enxerto IAC 766 sem afetar o enraizamento. No entanto, novos estudos são necessários ainda para validar a eficiência dessas técnicas de desinfecção.Item Colonization of vines by Petri disease fungi, susceptibility of rootstocks to Phaeomoniella chlamydospora and their disinfection(2018) Ferreira, Ana Beatriz Monteiro; Leite, Luís Garrigós; Hernandes, José Luiz; Harakava, Ricardo; Padovani, Carlos Roberto; Bueno, César JuniorABSTRACT: Petri disease is complex, attacks young vine plants and it is difficult to be controlled. The fungus Phaeomoniella chlamydospora (Phc) has been identified as the main causative agent of this disease. This study aimed to evaluate the prevalent colonization of the Petri disease fungi in different portions of vine plants; to assess the susceptibility of grapevine rootstocks to the fungus P. chlamydospora; to assess the effect of solarization and biofumigation, followed by hot-water treatment (HWT), on the disinfection of cuttings of the rootstock IAC 766 infected with P. chlamydospora, and assess the effect of solarization and biofumigation, followed by HWT, on the rooting of cuttings of the rootstock IAC 766. For the prevalent colonization test, the fungus species detected and identified in ‘Niagara Rosada’ grafted on two rootstocks different were Phc and Phialemoniopsis ocularis. This is the first report of P. ocularis in a young vineyard in Brazil. Both fungi, in particular Phc, colonized only the plant’s basal part, drawing attention to the rootstock as target for control measures. Measurement of the dark streaks in the vascular system revealed that Golia was the least susceptible rootstock, and IAC 572 was the most susceptible to Phc. Moreover, biofumigation or temperature of 37°C applied for 7 and 14 days, both followed by HWT, suppressed Phc in cuttings of the rootstock IAC 766 without hampering their rooting. Meanwhile, new studies are needed to validate the efficiency of these disinfection techniques. RESUMO: A doença de Petri é complexa, ataca plantas jovens de videira e é difícil de ser controlada. O fungo Phaeomoniella chlamydospora é o principal agente causal dessa doença. Os objetivos deste estudo foram: avaliar o local prevalente dos fungos da doença de Petri, em diferentes partes de plantas de videira; avaliar a suscetibilidade de porta-enxertos de videira para o fungo P. chlamydospora; avaliar o efeito da solarização e da biofumigação seguido de tratamento com água quente sobre a desinfecção de estacas do porta-enxerto IAC 766 infectadas com o fungo P. chlamydospora; avaliar o efeito da solarização e da biofumigação seguido de tratamento com água quente sobre o enraizamento de estacas do porta-enxerto IAC 766. Para o teste de colonização, as espécies de fungos detectadas e identificadas em Niagara Rosada enxertada em dois porta-enxertos diferentes foram P. chlamydospora e Phialemoniopsis ocularis. Este é o primeiro relato de P. ocularis em parrerais jovens de videira no Brasil. Ambos os fungos, em particular P. chlamydospora, colonizaram somente a parte basal das plantas, destacando-se os porta-enxertos como foco para medidas de controle. Medidas das estrias escuras no sistema vascular revelaram que Golia foi o porta-enxerto menos suscetível, e o IAC 572 foi o mais suscetíveis para P. chlamydospora. Além disso, a biofumigação ou a temperatura de 37ºC aplicadas por 7 e 14 dias seguidas de tratamento com água quente eliminaram P. chlamydospora em estacas do porta-enxerto IAC 766 sem afetar o enraizamento. No entanto, novos estudos são necessários ainda para validar a eficiência dessas técnicas de desinfecção.Item Colonization of vines by Petri disease fungi, susceptibility of rootstocks to Phaeomoniella chlamydospora and their disinfection(2018) Ferreira, Ana Beatriz Monteiro; Leite, Luís Garrigós; Hernandes, José Luiz; Harakava, Ricardo; Padovani, Carlos Roberto; Bueno, César JuniorABSTRACT: Petri disease is complex, attacks young vine plants and it is difficult to be controlled. The fungus Phaeomoniella chlamydospora (Phc) has been identified as the main causative agent of this disease. This study aimed to evaluate the prevalent colonization of the Petri disease fungi in different portions of vine plants; to assess the susceptibility of grapevine rootstocks to the fungus P. chlamydospora; to assess the effect of solarization and biofumigation, followed by hot-water treatment (HWT), on the disinfection of cuttings of the rootstock IAC 766 infected with P. chlamydospora, and assess the effect of solarization and biofumigation, followed by HWT, on the rooting of cuttings of the rootstock IAC 766. For the prevalent colonization test, the fungus species detected and identified in ‘Niagara Rosada’ grafted on two rootstocks different were Phc and Phialemoniopsis ocularis. This is the first report of P. ocularis in a young vineyard in Brazil. Both fungi, in particular Phc, colonized only the plant’s basal part, drawing attention to the rootstock as target for control measures. Measurement of the dark streaks in the vascular system revealed that Golia was the least susceptible rootstock, and IAC 572 was the most susceptible to Phc. Moreover, biofumigation or temperature of 37°C applied for 7 and 14 days, both followed by HWT, suppressed Phc in cuttings of the rootstock IAC 766 without hampering their rooting. Meanwhile, new studies are needed to validate the efficiency of these disinfection techniques. RESUMO: A doença de Petri é complexa, ataca plantas jovens de videira e é difícil de ser controlada. O fungo Phaeomoniella chlamydospora é o principal agente causal dessa doença. Os objetivos deste estudo foram: avaliar o local prevalente dos fungos da doença de Petri, em diferentes partes de plantas de videira; avaliar a suscetibilidade de porta-enxertos de videira para o fungo P. chlamydospora; avaliar o efeito da solarização e da biofumigação seguido de tratamento com água quente sobre a desinfecção de estacas do porta-enxerto IAC 766 infectadas com o fungo P. chlamydospora; avaliar o efeito da solarização e da biofumigação seguido de tratamento com água quente sobre o enraizamento de estacas do porta-enxerto IAC 766. Para o teste de colonização, as espécies de fungos detectadas e identificadas em Niagara Rosada enxertada em dois porta-enxertos diferentes foram P. chlamydospora e Phialemoniopsis ocularis. Este é o primeiro relato de P. ocularis em parrerais jovens de videira no Brasil. Ambos os fungos, em particular P. chlamydospora, colonizaram somente a parte basal das plantas, destacando-se os porta-enxertos como foco para medidas de controle. Medidas das estrias escuras no sistema vascular revelaram que Golia foi o porta-enxerto menos suscetível, e o IAC 572 foi o mais suscetíveis para P. chlamydospora. Além disso, a biofumigação ou a temperatura de 37ºC aplicadas por 7 e 14 dias seguidas de tratamento com água quente eliminaram P. chlamydospora em estacas do porta-enxerto IAC 766 sem afetar o enraizamento. No entanto, novos estudos são necessários ainda para validar a eficiência dessas técnicas de desinfecção.Item Incidência da doença de Petri na videira ‘Niagara Rosada’ no estado de São Paulo - Brasil(2017) Ferreira, Ana Beatriz Monteiro; Leite, Luís Garrigós; Harakava, Ricardo; Padovani, Carlos Roberto; Bueno, César JúniorABSTRACT The Petri disease caused mainly by Phaeomoniella chlamydospora and species of Phaeoacremonium is serious, complex, attacks young vine plants and is difficult to be controlled worldwide. In Brazil, São Paulo State is among the largest producers of ‘Niagara Rosada’ grapevine, and there is no official report of this disease in the state. Thus, the aims of the present study were to evaluate the incidence of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State and to compare methodologies to isolate the causal agents of this disease. Experimental design was completely randomized, testing three culture media (water-agar [WA], potato dextrose agar [PDA] and apple-green bait) with samples of diseased plants, disinfested or not, from nine sampling locality and eight replicates (Petri dish with the media and four fragments of the plants per sample). The number of colonies of causal agents per fragment per dish of each culture medium per locality was determined. Fungal isolates obtained by DNA extraction and sequencing of ITS-5.8S rDNA region [ITS1 TCCGTAGGTGAACCTGCGG and ITS4 TCCTCCGCTTATTGATATGC] and parts of the alpha elongase genes [EF1 ATGGGTAAGGARGACAAGAC and EF2 GGARGTACCAGTSATCATGTT] and beta tubulin genes [Bt2a GGTAACCAAATCGGTGCTGCTTTC and Bt2b ACCCTCAGTGTAGTGACCCTTGGC] were identified. Pathogenicity test was done with one isolate of Phaeomoniella spp. and one isolate of Phaeoacremonium spp. The disease incidence and severity (length of dark streaks in the vascular system) were evaluated. The municipalities Louveira B, Vinhedo, Jundiaí, Jarinu, Porto Feliz, Sao Miguel Arcanjo and Jales were the localities where the causal agents of the disease were present, demonstrating that the Petri disease occurs throughout São Paulo State. The most prevalent species of Phaeoacremonium was P. minimum (= P. aleophilum). Besides P. minimum, the species P. venezuelense was detected only in the municipality of Jales. P. chlamydospora was the only species identified within this genus. Isolation percentage was higher for P. chlamydospora than for Phaeoacremonium spp. The causal agents of the disease must be isolated by removing fragments of the vascular system from the collar region of symptomatic plants, followed by surface disinfection and plating of fragments in PDA culture medium. Incubation in BOD should be at 23ºC for up to 21 days. The apple-green bait method followed by culturing in PDA did not allow isolation of any of the causal agents of the disease. All inoculated plants developed external symptoms and internally the average length of dark streaks was 7.9 cm for P. chlamydospora and 5.2 cm for P. minimum. Control plants remained healthy. Fungi were re-isolated from diseased plants, completing the Koch’s postulates, thus making official the record of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State, Brazil. RESUMO A doença de Petri causada, principalmente, por Phaeomoniella chlamydospora e espécies de Phaeoacremonium é grave, complexa, ataca plantas jovens de videira e é de difícil controle no mundo. No Brasil, o estado de São Paulo está entre os maiores produtores da uva ‘Niagara Rosada’ e não há relato oficial desta doença no estado. Assim, os objetivos do presente trabalho foram avaliar a incidência da doença de Petri na videira ‘Niagara Rosada’ no estado de São Paulo e comparar metodologias para isolar os agentes causais da doença. O delineamento foi inteiramente casualizado, testando-se três meios de isolamento [ágar-água (AA), batata dextrose ágar (BDA) e isca de maçã-verde], com amostras de plantas doentes desinfestadas ou não, nove localidades de coleta e oito repetições (placa de Petri com os meios e quatro fragmentos das plantas por amostra). Anotou-se o número de colônias dos agentes causais por fragmento por placa de cada meio de cultura por localidade. Identificaram-se os isolados dos fungos obtidos por extração de DNA e sequenciamento da região ITS-5.8S do rDNA [ITS1 TCCGTAGGTGAACCTGCGG e ITS4 TCCTCCGCTTATTGATATGC] e partes dos genes da alfa elongase [EF1 ATGGGTAAGGARGACAAGAC e EF2 GGARGTACCAGTSATCATGTT] e da beta tubulina [Bt2a GGTAACCAAATCGGTGCTGCTTTC e Bt2b ACCCTCAGTGTAGTGACCCTTGGC]. Teste de patogenicidade foi feito com um isolado de Phaeomoniella spp. e um de Phaeoacremonium spp. A incidência e a severidade da doença (comprimento das estrias escuras no sistema vascular) foram avaliadas. Os municípios de Louveira B, Vinhedo, Jundiaí, Jarinú, Porto Feliz, São Miguel Arcanjo e Jales foram os que apresentaram a presença dos agentes causais da doença, demonstrando ocorrência da doença de Petri em todo o estado de São Paulo. A espécie de Phaeoacremonium prevalente foi P. minimum (= P. aleophilum). Somente na cidade de Jales, além de P. minimum detectou-se, também, a espécie P. venezuelense. Phaeomoniella chlamydospora foi a única espécie identificada neste gênero. A porcentagem de isolamento foi maior para P. chlamydospora do que para Phaeoacremonium spp. O isolamento dos agentes causais da doença deve ser feito retirando fragmentos do sistema vascular da região do colo das plantas sintomáticas seguido de desinfestação superficial e plaqueamento de fragmentos em meio de cultura BDA. Incuba-se em BOD, a 23ºC, por até 21 dias. O método de isca e depois repicagem para BDA não permitiu isolar nenhum dos agentes causais da doença. Todas as plantas inoculadas desenvolveram sintomas externos e internamente a média do comprimento das estrias escuras para P. chlamydospora foi de 7,9 cm e de P. minimum foi de 5,2 cm. As plantas controle (testemunha) permaneceram sadias. Os fungos foram re-isolados das plantas doentes, completando os postulados de Koch e oficializando a doença de Petri na videira ‘Niagara Rosada’ no estado de São Paulo - Brasil.